Transcript: Human NM_001352510.2

Homo sapiens solute carrier family 19 member 1 (SLC19A1), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-08-11
Taxon:
Homo sapiens (human)
Gene:
SLC19A1 (6573)
Length:
4995
CDS:
481..1902

Additional Resources:

NCBI RefSeq record:
NM_001352510.2
NBCI Gene record:
SLC19A1 (6573)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001352510.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000043132 CATCGCCTATTCCTCCTACAT pLKO.1 525 CDS 100% 4.950 6.930 N SLC19A1 n/a
2 TRCN0000043128 CCAGTTATACTCCGTGTACTT pLKO.1 1422 CDS 100% 4.950 3.960 N SLC19A1 n/a
3 TRCN0000043129 CGACGGTGTTCAGAATGTGAA pLKO.1 1875 CDS 100% 4.950 3.960 N SLC19A1 n/a
4 TRCN0000043131 CCGCAAGCAGTTCCAGTTATA pLKO.1 1410 CDS 100% 13.200 9.240 N SLC19A1 n/a
5 TRCN0000043130 GATTGCATCTTCTCTGTCTAA pLKO.1 1284 CDS 100% 4.950 3.465 N SLC19A1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001352510.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.