Transcript: Human NM_001352670.1

Homo sapiens nucleobindin 2 (NUCB2), transcript variant 12, mRNA.

Source:
NCBI, updated 2019-06-09
Taxon:
Homo sapiens (human)
Gene:
NUCB2 (4925)
Length:
1684
CDS:
282..1544

Additional Resources:

NCBI RefSeq record:
NM_001352670.1
NBCI Gene record:
NUCB2 (4925)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001352670.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000055526 CGAAGATAGAACCACCAGATA pLKO.1 409 CDS 100% 4.950 3.960 N NUCB2 n/a
2 TRCN0000300120 CGAAGATAGAACCACCAGATA pLKO_005 409 CDS 100% 4.950 3.960 N NUCB2 n/a
3 TRCN0000055527 GCTCAGAAGCTGGAATATCAT pLKO.1 1431 CDS 100% 5.625 3.938 N NUCB2 n/a
4 TRCN0000055523 CCACAGATTTAGATATGCTAA pLKO.1 736 CDS 100% 4.950 3.465 N NUCB2 n/a
5 TRCN0000300175 CCACAGATTTAGATATGCTAA pLKO_005 736 CDS 100% 4.950 3.465 N NUCB2 n/a
6 TRCN0000055525 CCAGGAAGCAAAGATCAACTA pLKO.1 948 CDS 100% 4.950 3.465 N NUCB2 n/a
7 TRCN0000300177 CCAGGAAGCAAAGATCAACTA pLKO_005 948 CDS 100% 4.950 3.465 N NUCB2 n/a
8 TRCN0000055524 GCTGGAATATCATCAGGTCAT pLKO.1 1439 CDS 100% 4.050 2.835 N NUCB2 n/a
9 TRCN0000300176 GCTGGAATATCATCAGGTCAT pLKO_005 1439 CDS 100% 4.050 2.835 N NUCB2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001352670.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.