Transcript: Human NM_001352852.1

Homo sapiens ST18 C2H2C-type zinc finger transcription factor (ST18), transcript variant 28, mRNA.

Source:
NCBI, updated 2019-08-21
Taxon:
Homo sapiens (human)
Gene:
ST18 (9705)
Length:
5696
CDS:
187..3330

Additional Resources:

NCBI RefSeq record:
NM_001352852.1
NBCI Gene record:
ST18 (9705)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001352852.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000013502 GCAATCTGGAACGGGACTATT pLKO.1 3248 CDS 100% 13.200 18.480 N ST18 n/a
2 TRCN0000434918 CTCTTATAGCTACGGTCAATG pLKO_005 1863 CDS 100% 10.800 15.120 N ST18 n/a
3 TRCN0000013498 GCTCAGAATTTGTTAGCAATA pLKO.1 4004 3UTR 100% 10.800 8.640 N ST18 n/a
4 TRCN0000414714 CATCTATGGAGAGCAACTTAA pLKO_005 3050 CDS 100% 13.200 9.240 N ST18 n/a
5 TRCN0000421152 CTGAATGAATCCAACCTTAAA pLKO_005 2992 CDS 100% 13.200 9.240 N St18 n/a
6 TRCN0000013501 CCACCTAGAGTCCCAAAGTAT pLKO.1 829 CDS 100% 5.625 3.938 N ST18 n/a
7 TRCN0000013499 GCCGAAATAGAAGTGGATGAA pLKO.1 1996 CDS 100% 4.950 3.465 N ST18 n/a
8 TRCN0000013500 GCAGCATTCTATCAGGCTCTT pLKO.1 2146 CDS 100% 4.050 2.835 N ST18 n/a
9 TRCN0000166364 CACACACACACACACACACAA pLKO.1 4558 3UTR 100% 4.950 2.475 Y KAAG1 n/a
10 TRCN0000172440 CACACACACACACACAGACAA pLKO.1 4564 3UTR 100% 4.950 2.475 Y LINC00955 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001352852.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.