Transcript: Human NM_001353059.2

Homo sapiens gelsolin (GSN), transcript variant 17, mRNA.

Source:
NCBI, updated 2019-09-29
Taxon:
Homo sapiens (human)
Gene:
GSN (2934)
Length:
2924
CDS:
490..2685

Additional Resources:

NCBI RefSeq record:
NM_001353059.2
NBCI Gene record:
GSN (2934)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001353059.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000029727 GCTCCAACAAGATTGGACGTT pLKO.1 2351 CDS 100% 0.264 0.370 N GSN n/a
2 TRCN0000352869 GCTCCAACAAGATTGGACGTT pLKO_005 2351 CDS 100% 0.264 0.370 N GSN n/a
3 TRCN0000029728 CACCAACCTTTATGGAGACTT pLKO.1 582 CDS 100% 4.950 3.465 N GSN n/a
4 TRCN0000343441 CACCAACCTTTATGGAGACTT pLKO_005 582 CDS 100% 4.950 3.465 N GSN n/a
5 TRCN0000029726 CGACAGCTACATCATTCTGTA pLKO.1 1749 CDS 100% 4.950 3.465 N GSN n/a
6 TRCN0000343402 CGACAGCTACATCATTCTGTA pLKO_005 1749 CDS 100% 4.950 3.465 N GSN n/a
7 TRCN0000071932 GACTTCTGCTAAGCGGTACAT pLKO.1 2508 CDS 100% 4.950 3.465 N Gsn n/a
8 TRCN0000324760 GACTTCTGCTAAGCGGTACAT pLKO_005 2508 CDS 100% 4.950 3.465 N Gsn n/a
9 TRCN0000029725 CCAACAGCAATCGGTATGAAA pLKO.1 1025 CDS 100% 5.625 3.375 N GSN n/a
10 TRCN0000343442 CCAACAGCAATCGGTATGAAA pLKO_005 1025 CDS 100% 5.625 3.375 N GSN n/a
11 TRCN0000029724 CCCACTGTTCAAGCAGTTCTT pLKO.1 1494 CDS 100% 4.950 2.970 N GSN n/a
12 TRCN0000343443 CCCACTGTTCAAGCAGTTCTT pLKO_005 1494 CDS 100% 4.950 2.970 N GSN n/a
13 TRCN0000071931 CTGCAGTATGACCTCCACTAT pLKO.1 658 CDS 100% 4.950 3.465 N Gsn n/a
14 TRCN0000324692 CTGCAGTATGACCTCCACTAT pLKO_005 658 CDS 100% 4.950 3.465 N Gsn n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001353059.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.