Transcript: Human NM_001353128.2

Homo sapiens centrosomal protein 112 (CEP112), transcript variant 7, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
CEP112 (201134)
Length:
3321
CDS:
146..2887

Additional Resources:

NCBI RefSeq record:
NM_001353128.2
NBCI Gene record:
CEP112 (201134)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001353128.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000244135 AGAATGCAACGGATGCAATTT pLKO_005 2897 3UTR 100% 13.200 18.480 N CEP112 n/a
2 TRCN0000244131 GACATTGAAGCTCGCCTTAAT pLKO_005 752 CDS 100% 13.200 18.480 N CEP112 n/a
3 TRCN0000183760 CAGATAACTTACATACGACAA pLKO.1 2714 CDS 100% 4.050 5.670 N CEP112 n/a
4 TRCN0000244132 ATACGTGACTGTCAAGTTATC pLKO_005 986 CDS 100% 10.800 8.640 N CEP112 n/a
5 TRCN0000244134 TGATCACTTTGTGGTTGATAT pLKO_005 196 CDS 100% 13.200 9.240 N CEP112 n/a
6 TRCN0000244133 CCGAGACCATGAACGGGAAAT pLKO_005 2080 CDS 100% 10.800 7.560 N CEP112 n/a
7 TRCN0000183634 GTTCACAAGTTGAGAGAAGAA pLKO.1 2207 CDS 100% 4.950 3.465 N CEP112 n/a
8 TRCN0000179475 GCAGAACTTCAGACAACCATT pLKO.1 2483 CDS 100% 4.950 2.970 N CEP112 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001353128.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13386 pDONR223 100% 99.9% 99.8% None 1287T>C;1525A>G n/a
2 ccsbBroad304_13386 pLX_304 0% 99.9% 99.8% V5 1287T>C;1525A>G n/a
Download CSV