Transcript: Human NM_001353354.2

Homo sapiens cytochrome b5 reductase like (CYB5RL), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-06-02
Taxon:
Homo sapiens (human)
Gene:
CYB5RL (606495)
Length:
6044
CDS:
573..1076

Additional Resources:

NCBI RefSeq record:
NM_001353354.2
NBCI Gene record:
CYB5RL (606495)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001353354.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000257099 GCGAGGACCTTTCGGAGATTT pLKO_005 629 CDS 100% 13.200 18.480 N CYB5RL n/a
2 TRCN0000218776 TGGTTGCTATGGAGATCTAAA pLKO_005 1811 3UTR 100% 13.200 10.560 N CYB5RL n/a
3 TRCN0000230553 ACCTGGGCCAGGACCTAATTA pLKO_005 928 CDS 100% 15.000 10.500 N CYB5RL n/a
4 TRCN0000230552 GGATACTTTGAAGTGTTAATT pLKO_005 540 5UTR 100% 15.000 10.500 N CYB5RL n/a
5 TRCN0000164460 CCTGTGTGTTTGACCTCTATC pLKO.1 381 5UTR 100% 10.800 7.560 N CYB5RL n/a
6 TRCN0000163727 GCCAACGCAGAAGGATACTTT pLKO.1 528 5UTR 100% 5.625 3.938 N CYB5RL n/a
7 TRCN0000162552 CGCAGAAGGATACTTTGAAGT pLKO.1 533 5UTR 100% 4.950 3.465 N CYB5RL n/a
8 TRCN0000162236 CTGTGTGTTTGACCTCTATCA pLKO.1 382 5UTR 100% 4.950 3.465 N CYB5RL n/a
9 TRCN0000158927 GAAGGATACTTTGAAGTGTTA pLKO.1 537 5UTR 100% 4.950 3.465 N CYB5RL n/a
10 TRCN0000163578 GTGTTTGACCTCTATCACCGA pLKO.1 386 5UTR 100% 0.660 0.462 N CYB5RL n/a
11 TRCN0000230554 CCTCACTGAGGACTCCTATTT pLKO_005 1046 CDS 100% 13.200 7.920 N CYB5RL n/a
12 TRCN0000007228 CACCTGTAATCCCAGCACTTT pLKO.1 5004 3UTR 100% 4.950 2.475 Y CFLAR n/a
13 TRCN0000166635 CACCTGTAATCCCAGCACTTT pLKO.1 5004 3UTR 100% 4.950 2.475 Y C19orf31 n/a
14 TRCN0000166201 CATGGTGAAACCCTGTCTCTA pLKO.1 5390 3UTR 100% 4.950 2.475 Y ORAI2 n/a
15 TRCN0000138140 GATTGAGACCATCCTGGCTAA pLKO.1 5059 3UTR 100% 4.050 2.025 Y LOC441087 n/a
16 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 3241 3UTR 100% 13.200 6.600 Y LIAS n/a
17 TRCN0000179120 CAACATGGTGAAACCCTGTTT pLKO.1 5387 3UTR 100% 4.950 2.475 Y LOC339059 n/a
18 TRCN0000021429 CACACCTGTAATCCCAGCATT pLKO.1 5002 3UTR 100% 4.950 2.475 Y ERN2 n/a
19 TRCN0000138998 CACACCTGTAATCCCAGCATT pLKO.1 5002 3UTR 100% 4.950 2.475 Y P3H4 n/a
20 TRCN0000344020 CACACCTGTAATCCCAGCATT pLKO_005 5002 3UTR 100% 4.950 2.475 Y P3H4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001353354.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.