Transcript: Human NM_001354529.1

Homo sapiens NADH:ubiquinone oxidoreductase complex assembly factor 6 (NDUFAF6), transcript variant 15, mRNA.

Source:
NCBI, updated 2019-08-06
Taxon:
Homo sapiens (human)
Gene:
NDUFAF6 (137682)
Length:
1939
CDS:
615..1160

Additional Resources:

NCBI RefSeq record:
NM_001354529.1
NBCI Gene record:
NDUFAF6 (137682)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001354529.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000322613 ACGGGATTATGAAGGTTATTT pLKO_005 235 5UTR 100% 15.000 21.000 N NDUFAF6 n/a
2 TRCN0000322686 CACTAGAAATATTGGGTATAA pLKO_005 724 CDS 100% 13.200 18.480 N NDUFAF6 n/a
3 TRCN0000131062 CAGAATCCCGAAGCTCTGTTT pLKO.1 276 5UTR 100% 4.950 6.930 N NDUFAF6 n/a
4 TRCN0000322611 CAGAATCCCGAAGCTCTGTTT pLKO_005 276 5UTR 100% 4.950 6.930 N NDUFAF6 n/a
5 TRCN0000147827 GAAACGGGATTATGAAGGTTA pLKO.1 232 5UTR 100% 4.950 6.930 N NDUFAF6 n/a
6 TRCN0000322680 TGACAAAGCATATCGTAATAT pLKO_005 650 CDS 100% 15.000 10.500 N NDUFAF6 n/a
7 TRCN0000322681 TACATGCTGAGCAGCTATAAC pLKO_005 1546 3UTR 100% 13.200 9.240 N NDUFAF6 n/a
8 TRCN0000267016 TCTACGGAGGAACCAAGATAA pLKO_005 896 CDS 100% 13.200 9.240 N Ndufaf6 n/a
9 TRCN0000149850 CTTTAATGTGGAACTGGCTCA pLKO.1 310 5UTR 100% 2.160 1.512 N NDUFAF6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001354529.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.