Transcript: Human NM_001354701.2

Homo sapiens sodium voltage-gated channel alpha subunit 5 (SCN5A), transcript variant 7, mRNA.

Source:
NCBI, updated 2019-07-21
Taxon:
Homo sapiens (human)
Gene:
SCN5A (6331)
Length:
8462
CDS:
210..6203

Additional Resources:

NCBI RefSeq record:
NM_001354701.2
NBCI Gene record:
SCN5A (6331)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001354701.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000437014 CACTAGAGCCACCAGCGATAA pLKO_005 6092 CDS 100% 10.800 15.120 N SCN5A n/a
2 TRCN0000444826 TGTCCCGCATGAGCAACTTGT pLKO_005 2602 CDS 100% 4.950 6.930 N SCN5A n/a
3 TRCN0000438207 CAGTGAAGATCTCGCCGACTT pLKO_005 6143 CDS 100% 4.050 5.670 N SCN5A n/a
4 TRCN0000437343 GTTAGAGGAGTCTCGCCACAA pLKO_005 2234 CDS 100% 4.050 5.670 N SCN5A n/a
5 TRCN0000043868 GCCGACAAGATGTTCACATAT pLKO.1 3930 CDS 100% 13.200 9.240 N SCN5A n/a
6 TRCN0000043870 GCTGGACTTTAGTGTGATTAT pLKO.1 794 CDS 100% 13.200 9.240 N SCN5A n/a
7 TRCN0000438284 AGAGGTGTCGGCCATGGTTAT pLKO_005 5855 CDS 100% 10.800 7.560 N SCN5A n/a
8 TRCN0000043872 CGAGACATTCATCATCTTCAT pLKO.1 3827 CDS 100% 4.950 3.465 N SCN5A n/a
9 TRCN0000043871 GCCATCATCGTGTTCATCTTT pLKO.1 2748 CDS 100% 5.625 3.375 N SCN5A n/a
10 TRCN0000043869 CCACTCAGTTTATTGAGTATT pLKO.1 5566 CDS 100% 1.320 0.792 N SCN5A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001354701.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.