Transcript: Human NM_001354845.1

Homo sapiens cyclin B1 (CCNB1), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-25
Taxon:
Homo sapiens (human)
Gene:
CCNB1 (891)
Length:
2010
CDS:
254..1396

Additional Resources:

NCBI RefSeq record:
NM_001354845.1
NBCI Gene record:
CCNB1 (891)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001354845.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000293916 ACTGACAACACTTATACTAAG pLKO_005 911 CDS 100% 10.800 15.120 N CCNB1 n/a
2 TRCN0000045292 GCCATGTTTATTGCAAGCAAA pLKO.1 845 CDS 100% 4.950 6.930 N CCNB1 n/a
3 TRCN0000293917 CTTGAGTTGGAGTACTATATT pLKO_005 1405 3UTR 100% 15.000 12.000 N CCNB1 n/a
4 TRCN0000298625 GACACCAACTCTACAACATTA pLKO_005 1177 CDS 100% 13.200 9.240 N CCNB1 n/a
5 TRCN0000087925 CCATGTTTATTGCAAGCAAAT pLKO.1 846 CDS 100% 10.800 7.560 N Ccnb1 n/a
6 TRCN0000332638 CCATGTTTATTGCAAGCAAAT pLKO_005 846 CDS 100% 10.800 7.560 N Ccnb1 n/a
7 TRCN0000045288 CCTGGCTAAGAATGTAGTCAT pLKO.1 1240 CDS 100% 4.950 3.465 N CCNB1 n/a
8 TRCN0000045291 GCCAAATACCTGATGGAACTA pLKO.1 1061 CDS 100% 4.950 3.465 N CCNB1 n/a
9 TRCN0000286480 GCCAAATACCTGATGGAACTA pLKO_005 1061 CDS 100% 4.950 3.465 N CCNB1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001354845.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.