Transcript: Human NM_001354859.2

Homo sapiens zinc finger protein 215 (ZNF215), transcript variant 8, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
ZNF215 (7762)
Length:
3469
CDS:
1114..1953

Additional Resources:

NCBI RefSeq record:
NM_001354859.2
NBCI Gene record:
ZNF215 (7762)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001354859.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000013054 CCGACGTACAAACCTTACTAA pLKO.1 1650 CDS 100% 5.625 7.875 N ZNF215 n/a
2 TRCN0000013057 GTACAGATATTCGACACCAAA pLKO.1 1490 CDS 100% 4.950 6.930 N ZNF215 n/a
3 TRCN0000431752 TGCCGAAGTTCATCCCTTATT pLKO_005 1564 CDS 100% 13.200 10.560 N ZNF215 n/a
4 TRCN0000013053 GCATACTAATATCCACCTGAT pLKO.1 2266 3UTR 100% 4.050 3.240 N ZNF215 n/a
5 TRCN0000422028 CATTAGCTCATGCGAATATAA pLKO_005 2380 3UTR 100% 15.000 10.500 N ZNF215 n/a
6 TRCN0000426086 GTCAGGACTTGGGTGAATTTA pLKO_005 938 5UTR 100% 15.000 10.500 N ZNF215 n/a
7 TRCN0000013055 CCTCTCTTATTCGACACCAAA pLKO.1 1823 CDS 100% 4.950 3.465 N ZNF215 n/a
8 TRCN0000013056 GCTGGAACAATTCCTGGCAAT pLKO.1 904 5UTR 100% 4.050 2.835 N ZNF215 n/a
9 TRCN0000433784 CAGTATCACCATACAAGTATT pLKO_005 2183 3UTR 100% 13.200 7.920 N ZNF215 n/a
10 TRCN0000235219 ACAGGAGAGAAACCCTATAAA pLKO_005 1603 CDS 100% 15.000 7.500 Y LOC66376 n/a
11 TRCN0000235327 ACAGGAGAGAAACCCTATAAA pLKO_005 1603 CDS 100% 15.000 7.500 Y OTTMUSG00000016228 n/a
12 TRCN0000243738 CAGGAGAGAAACCCTATAAAT pLKO_005 1604 CDS 100% 15.000 7.500 Y Gm14430 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001354859.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.