Transcript: Human NM_001354868.2

Homo sapiens thymidylate synthetase (TYMS), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
TYMS (7298)
Length:
1364
CDS:
91..783

Additional Resources:

NCBI RefSeq record:
NM_001354868.2
NBCI Gene record:
TYMS (7298)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001354868.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000045667 CTTTGGGAGATGCACATATTT pLKO.1 593 CDS 100% 15.000 10.500 N TYMS n/a
2 TRCN0000045664 CAGGTGACTTTATACACACTT pLKO.1 575 CDS 100% 4.950 3.465 N TYMS n/a
3 TRCN0000307761 CAGGTGACTTTATACACACTT pLKO_005 575 CDS 100% 4.950 3.465 N TYMS n/a
4 TRCN0000045666 GCAAAGAGTGATTGACACCAT pLKO.1 324 CDS 100% 2.640 1.848 N TYMS n/a
5 TRCN0000291655 GCAAAGAGTGATTGACACCAT pLKO_005 324 CDS 100% 2.640 1.848 N TYMS n/a
6 TRCN0000045663 CCCTGACGACAGAAGAATCAT pLKO.1 354 CDS 100% 5.625 3.375 N TYMS n/a
7 TRCN0000291719 CCCTGACGACAGAAGAATCAT pLKO_005 354 CDS 100% 5.625 3.375 N TYMS n/a
8 TRCN0000075941 GCACATATTTACCTGAATCAT pLKO.1 604 CDS 100% 5.625 3.938 N Tyms n/a
9 TRCN0000349520 GCACATATTTACCTGAATCAT pLKO_005 604 CDS 100% 5.625 3.938 N Tyms n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001354868.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.