Transcript: Human NM_001354900.2

Homo sapiens APC regulator of WNT signaling pathway (APC), transcript variant 9, mRNA.

Source:
NCBI, updated 2019-09-16
Taxon:
Homo sapiens (human)
Gene:
APC (324)
Length:
10605
CDS:
84..8492

Additional Resources:

NCBI RefSeq record:
NM_001354900.2
NBCI Gene record:
APC (324)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001354900.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000237830 AGTACAAGGATGCCAATATTA pLKO_005 2167 CDS 100% 15.000 21.000 N APC n/a
2 TRCN0000237828 GACTGTCCTTTCACCATATTT pLKO_005 2417 CDS 100% 15.000 21.000 N APC n/a
3 TRCN0000219015 ATGCGTTGGCACTTATCTATT pLKO_005 9527 3UTR 100% 13.200 18.480 N APC n/a
4 TRCN0000010297 TAATGAACACTACAGATAGAA pLKO.1 8796 3UTR 100% 5.625 7.875 N APC n/a
5 TRCN0000040096 GCCAACAAAGTCATCACGTAA pLKO.1 4709 CDS 100% 4.950 6.930 N APC n/a
6 TRCN0000237829 GATGATAAGCCTACCAATTAT pLKO_005 3369 CDS 100% 15.000 10.500 N APC n/a
7 TRCN0000040097 CCCAGTTTGTTTCTCAAGAAA pLKO.1 6011 CDS 100% 5.625 3.938 N APC n/a
8 TRCN0000010296 CAGATATGACCAGAAGGCAAT pLKO.1 451 CDS 100% 4.050 2.835 N APC n/a
9 TRCN0000040093 GCTGTGAAATTCACAGTAATA pLKO.1 8953 3UTR 100% 1.320 0.924 N APC n/a
10 TRCN0000040095 CCCTGCAAATAGCAGAAATAA pLKO.1 3862 CDS 100% 15.000 9.000 N APC n/a
11 TRCN0000244294 GAAAGTGGAGGTGGGATATTA pLKO_005 1857 CDS 100% 15.000 9.000 N APC n/a
12 TRCN0000040094 CCCAGAAATATGGGTGGCATA pLKO.1 6153 CDS 100% 4.050 2.430 N APC n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001354900.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.