Transcript: Human NM_001354903.2

Homo sapiens APC regulator of WNT signaling pathway (APC), transcript variant 12, mRNA.

Source:
NCBI, updated 2019-09-16
Taxon:
Homo sapiens (human)
Gene:
APC (324)
Length:
10401
CDS:
60..8288

Additional Resources:

NCBI RefSeq record:
NM_001354903.2
NBCI Gene record:
APC (324)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001354903.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000237830 AGTACAAGGATGCCAATATTA pLKO_005 1963 CDS 100% 15.000 21.000 N APC n/a
2 TRCN0000237828 GACTGTCCTTTCACCATATTT pLKO_005 2213 CDS 100% 15.000 21.000 N APC n/a
3 TRCN0000219015 ATGCGTTGGCACTTATCTATT pLKO_005 9323 3UTR 100% 13.200 18.480 N APC n/a
4 TRCN0000010297 TAATGAACACTACAGATAGAA pLKO.1 8592 3UTR 100% 5.625 7.875 N APC n/a
5 TRCN0000040096 GCCAACAAAGTCATCACGTAA pLKO.1 4505 CDS 100% 4.950 6.930 N APC n/a
6 TRCN0000237829 GATGATAAGCCTACCAATTAT pLKO_005 3165 CDS 100% 15.000 10.500 N APC n/a
7 TRCN0000040097 CCCAGTTTGTTTCTCAAGAAA pLKO.1 5807 CDS 100% 5.625 3.938 N APC n/a
8 TRCN0000010296 CAGATATGACCAGAAGGCAAT pLKO.1 604 CDS 100% 4.050 2.835 N APC n/a
9 TRCN0000040093 GCTGTGAAATTCACAGTAATA pLKO.1 8749 3UTR 100% 1.320 0.924 N APC n/a
10 TRCN0000040095 CCCTGCAAATAGCAGAAATAA pLKO.1 3658 CDS 100% 15.000 9.000 N APC n/a
11 TRCN0000244294 GAAAGTGGAGGTGGGATATTA pLKO_005 1653 CDS 100% 15.000 9.000 N APC n/a
12 TRCN0000040094 CCCAGAAATATGGGTGGCATA pLKO.1 5949 CDS 100% 4.050 2.430 N APC n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001354903.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.