Transcript: Human NM_001355247.2

Homo sapiens ubiquitin conjugating enzyme E2 L5 (UBE2L5), mRNA.

Source:
NCBI, updated 2019-06-30
Taxon:
Homo sapiens (human)
Gene:
UBE2L5 (171222)
Length:
2731
CDS:
964..1428

Additional Resources:

NCBI RefSeq record:
NM_001355247.2
NBCI Gene record:
UBE2L5 (171222)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001355247.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000272876 AGGTCTGTCTGCCAGTAATTA pLKO_005 1214 CDS 100% 15.000 7.500 Y UBE2L3 n/a
2 TRCN0000007209 CCAGCAGAGTACCCATTCAAA pLKO.1 1135 CDS 100% 5.625 2.813 Y UBE2L3 n/a
3 TRCN0000272938 CCAGCAGAGTACCCATTCAAA pLKO_005 1135 CDS 100% 5.625 2.813 Y UBE2L3 n/a
4 TRCN0000040825 GCTGAAGAGTTTACAAAGAAA pLKO.1 1381 CDS 100% 5.625 2.813 Y Ube2l3 n/a
5 TRCN0000317881 GCTGAAGAGTTTACAAAGAAA pLKO_005 1381 CDS 100% 5.625 2.813 Y Ube2l3 n/a
6 TRCN0000140719 GATCACTTGAGGTCAGGAGTT pLKO.1 549 5UTR 100% 4.050 2.025 Y P3H4 n/a
7 TRCN0000165299 GATCACTTGAGGTCAGGAGTT pLKO.1 549 5UTR 100% 4.050 2.025 Y ORAI2 n/a
8 TRCN0000352971 GATCACTTGAGGTCAGGAGTT pLKO_005 549 5UTR 100% 4.050 2.025 Y P3H4 n/a
9 TRCN0000007210 GCTAATTTATTGACTTGGCAA pLKO.1 1051 CDS 100% 2.640 1.320 Y UBE2L3 n/a
10 TRCN0000140536 GCCAACATGGTGAAACCTCAT pLKO.1 583 5UTR 100% 4.050 2.025 Y TLCD4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001355247.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.