Transcript: Human NM_001358413.1

Homo sapiens zinc finger and SCAN domain containing 5C (ZSCAN5C), mRNA.

Source:
NCBI, updated 2019-09-29
Taxon:
Homo sapiens (human)
Gene:
ZSCAN5C (649137)
Length:
1491
CDS:
1..1491

Additional Resources:

NCBI RefSeq record:
NM_001358413.1
NBCI Gene record:
ZSCAN5C (649137)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001358413.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

No results found.

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001358413.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04057 pDONR223 100% 91% 83.6% None (many diffs) n/a
2 ccsbBroad304_04057 pLX_304 0% 91% 83.6% V5 (many diffs) n/a
3 TRCN0000469478 CGCTGCCAATCCTCCGATCTCTAG pLX_317 26% 91% 83.6% V5 (many diffs) n/a
Download CSV