Transcript: Mouse NM_001360713.1

Mus musculus symplekin (Sympk), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-02-27
Taxon:
Mus musculus (mouse)
Gene:
Sympk (68188)
Length:
4204
CDS:
150..3206

Additional Resources:

NCBI RefSeq record:
NM_001360713.1
NBCI Gene record:
Sympk (68188)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001360713.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000346854 CTGATTGCATTGCACAATATT pLKO_005 2985 CDS 100% 15.000 21.000 N Sympk n/a
2 TRCN0000346791 TCAGGCACTCTGGACAAATAT pLKO_005 2055 CDS 100% 15.000 10.500 N Sympk n/a
3 TRCN0000346795 TGGCTCTACCAGGAATATAAT pLKO_005 2013 CDS 100% 15.000 10.500 N Sympk n/a
4 TRCN0000346793 CCCAGGCCTTGCTCTTCATTA pLKO_005 2338 CDS 100% 13.200 9.240 N Sympk n/a
5 TRCN0000346794 TTCGAGAGTATGTGGAGAAAT pLKO_005 2383 CDS 100% 13.200 9.240 N Sympk n/a
6 TRCN0000166364 CACACACACACACACACACAA pLKO.1 3278 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001360713.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.