Transcript: Human NM_001361190.1

Homo sapiens zinc finger containing ubiquitin peptidase 1 (ZUP1), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-02-27
Taxon:
Homo sapiens (human)
Gene:
ZUP1 (221302)
Length:
1916
CDS:
470..1702

Additional Resources:

NCBI RefSeq record:
NM_001361190.1
NBCI Gene record:
ZUP1 (221302)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001361190.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000229397 GAAGCACTTCATAGGTATTAT pLKO_005 935 CDS 100% 15.000 21.000 N ZUP1 n/a
2 TRCN0000129105 CCCTCGCTTATTTGAATGGAT pLKO.1 1330 CDS 100% 3.000 4.200 N ZUP1 n/a
3 TRCN0000229398 GGTACACACCCTCGCTTATTT pLKO_005 1322 CDS 100% 15.000 12.000 N ZUP1 n/a
4 TRCN0000241318 GGTACACACCCTCGCTTATTT pLKO_005 1322 CDS 100% 15.000 12.000 N Zufsp n/a
5 TRCN0000129655 CCTAAGGGTAAAGTGTCATAT pLKO.1 1270 CDS 100% 13.200 10.560 N ZUP1 n/a
6 TRCN0000229396 AGTCCAGCCTGACCGAAATAA pLKO_005 372 5UTR 100% 15.000 10.500 N ZUP1 n/a
7 TRCN0000218130 CAACAACAACTACGAAATATG pLKO_005 794 CDS 100% 13.200 9.240 N ZUP1 n/a
8 TRCN0000147954 GACAAGCTTCTCAAGTCTTTA pLKO.1 1662 CDS 100% 13.200 9.240 N ZUP1 n/a
9 TRCN0000219806 ATTTAAGCATTTCAGTGATTG pLKO.1 1713 3UTR 100% 10.800 7.560 N ZUP1 n/a
10 TRCN0000219807 GTGATTGAGAACAATACTTTG pLKO.1 1727 3UTR 100% 10.800 7.560 N ZUP1 n/a
11 TRCN0000229399 GTGATTGAGAACAATACTTTG pLKO_005 1727 3UTR 100% 10.800 7.560 N ZUP1 n/a
12 TRCN0000130740 GCTTTCAGCAAGGCATGGATA pLKO.1 624 CDS 100% 4.950 3.465 N ZUP1 n/a
13 TRCN0000150071 CATGTTGACTTGCATTTGGAA pLKO.1 596 CDS 100% 3.000 1.800 N ZUP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001361190.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05254 pDONR223 100% 70.9% 70.9% None 0_1ins504 n/a
Download CSV