Transcript: Human NM_001362663.2

Homo sapiens transducin beta like 2 (TBL2), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-08-03
Taxon:
Homo sapiens (human)
Gene:
TBL2 (26608)
Length:
4420
CDS:
602..1450

Additional Resources:

NCBI RefSeq record:
NM_001362663.2
NBCI Gene record:
TBL2 (26608)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001362663.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000323108 GGTGCGAGCCTTCGAACTAAA pLKO_005 913 CDS 100% 13.200 18.480 N TBL2 n/a
2 TRCN0000158220 CGCCAACTTGTCCTTTGACAT pLKO.1 1234 CDS 100% 4.950 6.930 N TBL2 n/a
3 TRCN0000156411 CCTGTCATCGACATTGGCATT pLKO.1 674 CDS 100% 4.050 5.670 N TBL2 n/a
4 TRCN0000150813 GAACATATCTTGCATGGACTT pLKO.1 402 5UTR 100% 4.050 3.240 N TBL2 n/a
5 TRCN0000323033 ACATATCTTGCATGGACTTTA pLKO_005 404 5UTR 100% 13.200 9.240 N TBL2 n/a
6 TRCN0000323235 TTGGCCAGTGGCAGTAGTATT pLKO_005 1148 CDS 100% 13.200 9.240 N TBL2 n/a
7 TRCN0000323118 AGAGAACACCTGAGTACTAAG pLKO_005 1821 3UTR 100% 10.800 7.560 N TBL2 n/a
8 TRCN0000156169 CATCGACATTGGCATTGCTAA pLKO.1 679 CDS 100% 4.950 3.465 N TBL2 n/a
9 TRCN0000151429 GCAAAGATGATATGAGGCTAA pLKO.1 1980 3UTR 100% 4.050 2.835 N TBL2 n/a
10 TRCN0000156310 CCAGATGTGAAGGTTTGGGAA pLKO.1 857 CDS 100% 2.640 1.848 N TBL2 n/a
11 TRCN0000156715 GCTGTCTACCATCAACACCAA pLKO.1 769 CDS 100% 2.640 1.848 N TBL2 n/a
12 TRCN0000323032 GCTGTCTACCATCAACACCAA pLKO_005 769 CDS 100% 2.640 1.848 N TBL2 n/a
13 TRCN0000158250 CACCTGACAAATCTTCGGGAT pLKO.1 281 5UTR 100% 2.160 1.512 N TBL2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001362663.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.