Transcript: Mouse NM_001362674.1

Mus musculus solute carrier family 4, sodium bicarbonate cotransporter-like, member 10 (Slc4a10), transcript variant 11, mRNA.

Source:
NCBI, updated 2019-09-25
Taxon:
Mus musculus (mouse)
Gene:
Slc4a10 (94229)
Length:
5539
CDS:
210..3473

Additional Resources:

NCBI RefSeq record:
NM_001362674.1
NBCI Gene record:
Slc4a10 (94229)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001362674.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000351076 AGCAACTGAAGGTCGTATAAG pLKO_005 1715 CDS 100% 13.200 18.480 N Slc4a10 n/a
2 TRCN0000339143 CAGATCGATTGCGACCTTAAT pLKO_005 1280 CDS 100% 13.200 18.480 N Slc4a10 n/a
3 TRCN0000351075 CGACCCGTCTGTGATCAATAT pLKO_005 3347 CDS 100% 13.200 10.560 N Slc4a10 n/a
4 TRCN0000339144 TAGAAGGTCATCGGACATTAT pLKO_005 331 CDS 100% 13.200 10.560 N Slc4a10 n/a
5 TRCN0000079224 CGGACATTATTTATTGGAGTT pLKO.1 342 CDS 100% 4.050 3.240 N Slc4a10 n/a
6 TRCN0000339142 TAACCTGAAGATGCCTGATAA pLKO_005 3893 3UTR 100% 13.200 9.240 N Slc4a10 n/a
7 TRCN0000079226 CCAGTGTTATACGGAGTGTTT pLKO.1 2922 CDS 100% 4.950 3.465 N Slc4a10 n/a
8 TRCN0000079227 GCCAGTGTTATACGGAGTGTT pLKO.1 2921 CDS 100% 4.950 3.465 N Slc4a10 n/a
9 TRCN0000079225 GCTCAGTGAAACCTATCCAAT pLKO.1 2054 CDS 100% 4.950 3.465 N Slc4a10 n/a
10 TRCN0000079223 GCTGCTAAGTTTGGTTCCTAT pLKO.1 4411 3UTR 100% 4.950 3.465 N Slc4a10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001362674.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.