Transcript: Human NM_001363000.2

Homo sapiens thioesterase superfamily member 6 (THEM6), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
THEM6 (51337)
Length:
2080
CDS:
125..592

Additional Resources:

NCBI RefSeq record:
NM_001363000.2
NBCI Gene record:
THEM6 (51337)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001363000.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000263647 ACTCCTCTGTCCTCTATATTC pLKO_005 1535 3UTR 100% 13.200 9.240 N THEM6 n/a
2 TRCN0000282738 ATGGAGAGTGGGCTCAGTGAT pLKO_005 554 CDS 100% 4.950 3.465 N THEM6 n/a
3 TRCN0000282740 AGCACTGGATCTCCTACAACG pLKO_005 510 CDS 100% 4.050 2.835 N THEM6 n/a
4 TRCN0000263648 CCTGCTGCTGCACATGAACAA pLKO_005 304 CDS 100% 4.950 2.970 N THEM6 n/a
5 TRCN0000281531 GATGTCACCAAGGACCAGTGA pLKO_005 572 CDS 100% 2.640 1.584 N THEM6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001363000.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000475673 GGGAGTTAGACCTAAAGGTGGCCT pLX_317 36.8% 74.5% 74.5% V5 353_354ins159 n/a
2 ccsbBroadEn_15064 pDONR223 91.1% 74.4% 72.7% None 353_354ins159;454_455insC n/a
3 ccsbBroad304_15064 pLX_304 0% 74.4% 72.7% V5 (not translated due to frame shift) 353_354ins159;454_455insC n/a
Download CSV