Construct: ORF TRCN0000475673
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF009926.1_s317c1
- Derived from:
- ccsbBroadEn_15064
- DNA Barcode:
- GGGAGTTAGACCTAAAGGTGGCCT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- THEM6 (51337)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000475673
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 51337 | THEM6 | thioesterase superfamily me... | NM_016647.3 | 100% | 100% | |
| 2 | human | 51337 | THEM6 | thioesterase superfamily me... | NM_001363000.2 | 74.5% | 74.5% | 353_354ins159 |
| 3 | human | 51337 | THEM6 | thioesterase superfamily me... | NR_156431.2 | 22.5% | 1_124del;637_1166del;1279_2769del | |
| 4 | mouse | 223626 | Them6 | thioesterase superfamily me... | NM_198607.1 | 83.8% | 87.5% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 690
- ORF length:
- 624
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgct ggggctgctg gtggcgttgc tggccctggg gctcgctgtc tttgcgctgc 121 tggacgtctg gtacctggtg cgccttccgt gcgccgtgct gcgcgcgcgc ctgctgcagc 181 cgcgcgtccg tgacctgcta gctgagcagc gcttcccggg ccgcgtgctg ccctcggact 241 tggacctgct gctgcacatg aacaacgcgc gctacctgcg cgaggccgac tttgcgcgcg 301 tcgcgcacct gacccgctgc ggggtgctcg gggcgctgag ggagttgcgg gcgcacacgg 361 tgctggcggc ctcgtgcgcg cgccaccgcc gctcgctgcg cctgctggag cccttcgagg 421 tgcgcacccg cctgctgggc tgggacgacc gcgcgttcta cctGGAGGCG CGCTTTGTCA 481 GCCTGCGGGA CGGCTTCGTG TGCGCGCTGC TGCGCTTCCG GCAGCACCTG CTGGGCACCT 541 CACCCGAGCG CGTCGTGCAG CACCTGTGCC AGCGCAGGGT GGAGCCCCCT GAGCTGCCCG 601 CTGATCTGCA GCACTGGATC TCCTACAACG AGGCCAGCAG CCAGCTGCTC CGCATGGAGA 661 GTGGGCTCAG TGATGTCACC AAGGACCAGT GCCCAACTTT CTTGTACAAA GTGGTTGATA 721 TCGGTAAGCC TATCCCTAAC CCTCTCCTCG GTCTCGATTC TACGTAGTAA TGAACTAGTC 781 CGTAACTTGA AAGTATTTCG ATTTCTTGGC TTTATATATC TTGTGGAAAG GACGAGGGAG 841 TTAGACCTAA AGGTGGCCTA CGCGTTAAGT Cgacaatcaa cctctggatt acaaaatttg 901 tgaaagatt