Transcript: Human NM_001363745.2

Homo sapiens solute carrier family 4 member 11 (SLC4A11), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-07-07
Taxon:
Homo sapiens (human)
Gene:
SLC4A11 (83959)
Length:
2932
CDS:
54..2567

Additional Resources:

NCBI RefSeq record:
NM_001363745.2
NBCI Gene record:
SLC4A11 (83959)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001363745.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000415148 GGCATTACTTGGACGACTATC pLKO_005 1450 CDS 100% 10.800 15.120 N SLC4A11 n/a
2 TRCN0000038265 CGAGGATTCAAGCTACTACAA pLKO.1 131 CDS 100% 4.950 6.930 N SLC4A11 n/a
3 TRCN0000418938 GCCGTCAAGGGCACGGTTAAA pLKO_005 1407 CDS 100% 4.400 6.160 N SLC4A11 n/a
4 TRCN0000038266 CGGACACATCTATGACACGAT pLKO.1 2114 CDS 100% 2.640 3.696 N SLC4A11 n/a
5 TRCN0000428654 GTTTCTTCCTTGCGCTTTATG pLKO_005 1294 CDS 100% 13.200 10.560 N SLC4A11 n/a
6 TRCN0000038267 CCCGAAAGTACCTGAAGTTAA pLKO.1 337 CDS 100% 13.200 9.240 N SLC4A11 n/a
7 TRCN0000038264 CCCTACATGAAGATGATCTTT pLKO.1 2445 CDS 100% 5.625 3.938 N SLC4A11 n/a
8 TRCN0000421782 GACTTCACTGATGGCATTATT pLKO_005 1083 CDS 100% 15.000 9.000 N SLC4A11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001363745.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.