Transcript: Human NM_001364278.2

Homo sapiens interleukin 6 signal transducer (IL6ST), transcript variant 8, mRNA.

Source:
NCBI, updated 2019-09-18
Taxon:
Homo sapiens (human)
Gene:
IL6ST (3572)
Length:
8906
CDS:
1066..2919

Additional Resources:

NCBI RefSeq record:
NM_001364278.2
NBCI Gene record:
IL6ST (3572)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001364278.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000296316 ACCGTGCATCGCACCTATTTA pLKO_005 1588 CDS 100% 15.000 21.000 N IL6ST n/a
2 TRCN0000296317 ACTTCAGCAGTACCTATAAAG pLKO_005 2942 3UTR 100% 13.200 9.240 N IL6ST n/a
3 TRCN0000058284 CCAGTCCAGATATTTCACATT pLKO.1 2633 CDS 100% 4.950 3.465 N IL6ST n/a
4 TRCN0000289773 CCAGTCCAGATATTTCACATT pLKO_005 2633 CDS 100% 4.950 3.465 N IL6ST n/a
5 TRCN0000058283 GCCACATAATTTATCAGTGAT pLKO.1 834 5UTR 100% 4.950 3.465 N IL6ST n/a
6 TRCN0000058286 GCAACACACAAGTTTGCTGAT pLKO.1 655 5UTR 100% 4.050 2.835 N IL6ST n/a
7 TRCN0000058287 CGGCCAGAAGATCTACAATTA pLKO.1 2536 CDS 100% 13.200 7.920 N IL6ST n/a
8 TRCN0000289712 CGGCCAGAAGATCTACAATTA pLKO_005 2536 CDS 100% 13.200 7.920 N IL6ST n/a
9 TRCN0000058285 CCCATACTCAAGGCTACAGAA pLKO.1 1178 CDS 100% 4.950 2.970 N IL6ST n/a
10 TRCN0000289711 CCCATACTCAAGGCTACAGAA pLKO_005 1178 CDS 100% 4.950 2.970 N IL6ST n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001364278.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.