Transcript: Human NM_001364297.1

Homo sapiens LIF receptor subunit alpha (LIFR), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
LIFR (3977)
Length:
10570
CDS:
353..3646

Additional Resources:

NCBI RefSeq record:
NM_001364297.1
NBCI Gene record:
LIFR (3977)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001364297.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000421659 TGACTTGCGACTACGTCATTA pLKO_005 2310 CDS 100% 13.200 18.480 N LIFR n/a
2 TRCN0000058769 CCACCCATCATTGAGGAAGAA pLKO.1 3203 CDS 100% 4.950 6.930 N LIFR n/a
3 TRCN0000058771 CCTACAATGTATCGTGTTCAT pLKO.1 2061 CDS 100% 4.950 6.930 N LIFR n/a
4 TRCN0000058772 GCTCCATTAATTCCCGACAAT pLKO.1 3534 CDS 100% 4.950 6.930 N LIFR n/a
5 TRCN0000430362 ACTTCTGCAGATTCGATATTA pLKO_005 2555 CDS 100% 15.000 12.000 N LIFR n/a
6 TRCN0000421383 GTAGGCTCAGACATAACATTT pLKO_005 1139 CDS 100% 13.200 9.240 N LIFR n/a
7 TRCN0000427511 TGAAGTGTGTAACTAACAATT pLKO_005 510 CDS 100% 13.200 9.240 N LIFR n/a
8 TRCN0000058768 GCTCCCATTGTTGCACCAAAT pLKO.1 2519 CDS 100% 10.800 7.560 N LIFR n/a
9 TRCN0000058770 CCTCAGATATGCCCTTGGAAT pLKO.1 969 CDS 100% 4.950 3.465 N LIFR n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001364297.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.