Transcript: Mouse NM_001364543.1

Mus musculus zinc finger and BTB domain containing 16 (Zbtb16), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-13
Taxon:
Mus musculus (mouse)
Gene:
Zbtb16 (235320)
Length:
7628
CDS:
262..2283

Additional Resources:

NCBI RefSeq record:
NM_001364543.1
NBCI Gene record:
Zbtb16 (235320)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001364543.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000257073 CAGGCGTGCGCAGCTATATTT pLKO_005 1799 CDS 100% 15.000 21.000 N Zbtb16 n/a
2 TRCN0000239235 CGTGGTCTCCTGCCGTTAATA pLKO_005 4037 3UTR 100% 15.000 21.000 N Zbtb16 n/a
3 TRCN0000239236 ACGTACCTCTACCTGTGTTAT pLKO_005 2257 CDS 100% 13.200 10.560 N Zbtb16 n/a
4 TRCN0000239238 TGGACAGCTTGATGAGTATAG pLKO_005 869 CDS 100% 10.800 7.560 N Zbtb16 n/a
5 TRCN0000012941 CCGGGATGAGAGCACACTCAA pLKO.1 1926 CDS 100% 1.650 1.155 N ZBTB16 n/a
6 TRCN0000239237 TGCGACTGAGAATGCATTTAC pLKO_005 1595 CDS 100% 13.200 7.920 N Zbtb16 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001364543.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07165 pDONR223 100% 90.4% 96.5% None (many diffs) n/a
2 ccsbBroad304_07165 pLX_304 0% 90.4% 96.5% V5 (many diffs) n/a
Download CSV