Transcript: Human NM_001364614.2

Homo sapiens lysine demethylase 1B (KDM1B), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-03
Taxon:
Homo sapiens (human)
Gene:
KDM1B (221656)
Length:
4538
CDS:
208..2676

Additional Resources:

NCBI RefSeq record:
NM_001364614.2
NBCI Gene record:
KDM1B (221656)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001364614.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000257375 GGGTCTTCAGGATGCCTATTT pLKO_005 3782 3UTR 100% 13.200 18.480 N KDM1B n/a
2 TRCN0000236734 TCCCGGGTACTCGGTGATAAT pLKO_005 1935 CDS 100% 13.200 18.480 N KDM1B n/a
3 TRCN0000046075 GCCGTGTTCTATGACATGGAT pLKO.1 2290 CDS 100% 3.000 4.200 N KDM1B n/a
4 TRCN0000046077 CCACTGGCTTTACTACAGAAA pLKO.1 2089 CDS 100% 4.950 3.960 N KDM1B n/a
5 TRCN0000236735 GCCGAGTCTGGGATGATAAAT pLKO_005 1463 CDS 100% 15.000 10.500 N KDM1B n/a
6 TRCN0000236736 TGAAACCAAATACTGCTATTA pLKO_005 719 CDS 100% 13.200 9.240 N KDM1B n/a
7 TRCN0000236737 TTAACAACCCAGTAGCATTAA pLKO_005 1535 CDS 100% 13.200 9.240 N KDM1B n/a
8 TRCN0000046076 CCATTACTACAGAAGCCATAA pLKO.1 498 CDS 100% 10.800 7.560 N KDM1B n/a
9 TRCN0000046074 GCAAGCAAGATTGCAGCATTT pLKO.1 2653 CDS 100% 10.800 7.560 N KDM1B n/a
10 TRCN0000046073 CCACAATAAATCAGTCATCAT pLKO.1 1347 CDS 100% 4.950 3.465 N KDM1B n/a
11 TRCN0000076615 CCTGGCTTTGAGAAACCTCAT pLKO.1 1128 CDS 100% 4.050 2.430 N Kdm1b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001364614.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.