Transcript: Human NM_001364690.1

Homo sapiens chromosome 4 open reading frame 50 (C4orf50), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-26
Taxon:
Homo sapiens (human)
Gene:
C4orf50 (389197)
Length:
6368
CDS:
116..4105

Additional Resources:

NCBI RefSeq record:
NM_001364690.1
NBCI Gene record:
C4orf50 (389197)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001364690.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000424559 AGTCCAGGACGGATCTCATAG pLKO_005 4578 3UTR 100% 10.800 15.120 N C4orf50 n/a
2 TRCN0000173109 CCATAAATCACCGCTGGAGTT pLKO.1 4075 CDS 100% 4.050 5.670 N C4orf50 n/a
3 TRCN0000167197 CATACCTCTTGAATCCTGAAA pLKO.1 3738 CDS 100% 4.950 3.960 N C4orf50 n/a
4 TRCN0000168063 CCAAGAGCTTAGACAAAGCAT pLKO.1 4036 CDS 100% 3.000 2.400 N C4orf50 n/a
5 TRCN0000415353 AGCAATCAGAGCCCTCATTTA pLKO_005 4191 3UTR 100% 13.200 9.240 N C4orf50 n/a
6 TRCN0000168200 CAGCTTTAAGAGCTCAGACAT pLKO.1 3720 CDS 100% 4.950 3.465 N C4orf50 n/a
7 TRCN0000172287 CCTGGCAAATTCTGAGGAGTT pLKO.1 4286 3UTR 100% 4.050 2.835 N C4orf50 n/a
8 TRCN0000172472 CCAACTGGATTCTCTGAAGCT pLKO.1 3835 CDS 100% 2.640 1.848 N C4orf50 n/a
9 TRCN0000168462 GAATCCTGAAATGGACAGTGT pLKO.1 3748 CDS 100% 2.640 1.848 N C4orf50 n/a
10 TRCN0000172699 GCTCATTGTCTTCAGAGTCCT pLKO.1 3777 CDS 100% 2.640 1.848 N C4orf50 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001364690.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.