Transcript: Human NM_001364837.1

Homo sapiens methylenetetrahydrofolate dehydrogenase, cyclohydrolase and formyltetrahydrofolate synthetase 1 (MTHFD1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-26
Taxon:
Homo sapiens (human)
Gene:
MTHFD1 (4522)
Length:
3060
CDS:
76..2970

Additional Resources:

NCBI RefSeq record:
NM_001364837.1
NBCI Gene record:
MTHFD1 (4522)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001364837.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000036525 GCAGATGACATTGAATTACTT pLKO.1 2581 CDS 100% 5.625 7.875 N MTHFD1 n/a
2 TRCN0000333052 GCAGATGACATTGAATTACTT pLKO_005 2581 CDS 100% 5.625 7.875 N MTHFD1 n/a
3 TRCN0000036528 GCCATTGATGCTCGGATATTT pLKO.1 1450 CDS 100% 15.000 10.500 N MTHFD1 n/a
4 TRCN0000333051 GCCATTGATGCTCGGATATTT pLKO_005 1450 CDS 100% 15.000 10.500 N MTHFD1 n/a
5 TRCN0000036527 CCAAGCGTTTCCTGGAGAAAT pLKO.1 947 CDS 100% 13.200 9.240 N MTHFD1 n/a
6 TRCN0000333050 CCAAGCGTTTCCTGGAGAAAT pLKO_005 947 CDS 100% 13.200 9.240 N MTHFD1 n/a
7 TRCN0000036524 GCTGAAGAGATTGGGATCAAA pLKO.1 253 CDS 100% 5.625 3.938 N MTHFD1 n/a
8 TRCN0000333118 GCTGAAGAGATTGGGATCAAA pLKO_005 253 CDS 100% 5.625 3.938 N MTHFD1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001364837.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.