Transcript: Human NM_001365323.2

Homo sapiens terminal nucleotidyltransferase 4B (TENT4B), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-11
Taxon:
Homo sapiens (human)
Gene:
TENT4B (64282)
Length:
8219
CDS:
156..2237

Additional Resources:

NCBI RefSeq record:
NM_001365323.2
NBCI Gene record:
TENT4B (64282)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001365323.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000049375 GCCACATATAGAGATTGGATA pLKO.1 1641 CDS 100% 4.950 6.930 N TENT4B n/a
2 TRCN0000049373 CCAACAAATCTCAGCATGGAT pLKO.1 2047 CDS 100% 3.000 4.200 N TENT4B n/a
3 TRCN0000049374 CCCAATACAAACTATGGTGTT pLKO.1 1290 CDS 100% 4.050 2.835 N TENT4B n/a
4 TRCN0000049376 GCCTTTGATTATGCCTACGTT pLKO.1 1524 CDS 100% 3.000 2.100 N TENT4B n/a
5 TRCN0000049377 CGATGTTGGAAGGAGTTCATA pLKO.1 1481 CDS 100% 5.625 3.375 N TENT4B n/a
6 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 7100 3UTR 100% 4.950 2.475 Y ERAP2 n/a
7 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 7101 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001365323.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.