Transcript: Human NM_001365536.1

Homo sapiens sodium voltage-gated channel alpha subunit 9 (SCN9A), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-03
Taxon:
Homo sapiens (human)
Gene:
SCN9A (6335)
Length:
9752
CDS:
299..6265

Additional Resources:

NCBI RefSeq record:
NM_001365536.1
NBCI Gene record:
SCN9A (6335)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001365536.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000424746 TCGTTGTGAATGCACTCATAG pLKO_005 4224 CDS 100% 10.800 15.120 N SCN9A n/a
2 TRCN0000044503 GCCCTCATTGAACAACGCATT pLKO.1 359 CDS 100% 4.050 5.670 N SCN9A n/a
3 TRCN0000426857 TTAAGGGATGGACGATTATTA pLKO_005 4512 CDS 100% 15.000 10.500 N SCN9A n/a
4 TRCN0000044506 CGGCTGAATATACAAGTATTA pLKO.1 1629 CDS 100% 13.200 9.240 N SCN9A n/a
5 TRCN0000433360 GAATCCTACGTCTAGTCAAAG pLKO_005 5154 CDS 100% 10.800 7.560 N SCN9A n/a
6 TRCN0000044507 CCTTCCAAAGTGTCCTATGAA pLKO.1 5912 CDS 100% 5.625 3.938 N SCN9A n/a
7 TRCN0000044504 CCCTTATGAATGTTAGTCAAA pLKO.1 4413 CDS 100% 4.950 3.465 N SCN9A n/a
8 TRCN0000044505 GCTGATTTGATTGAAACGTAT pLKO.1 5084 CDS 100% 4.950 3.465 N SCN9A n/a
9 TRCN0000173720 CTTCGTTCACAGATGGAAGAA pLKO.1 5873 CDS 100% 4.950 2.970 N Scn9a n/a
10 TRCN0000430981 GCCACCATGCCTGGCTAATTT pLKO_005 9021 3UTR 100% 15.000 7.500 Y GTF2IRD2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001365536.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.