Transcript: Human NM_001365712.1

Homo sapiens vesicle transport through interaction with t-SNAREs 1A (VTI1A), transcript variant 9, mRNA.

Source:
NCBI, updated 2019-06-08
Taxon:
Homo sapiens (human)
Gene:
VTI1A (143187)
Length:
4206
CDS:
160..744

Additional Resources:

NCBI RefSeq record:
NM_001365712.1
NBCI Gene record:
VTI1A (143187)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001365712.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000236388 GAGGGCACATCTGCTCGATAA pLKO_005 522 CDS 100% 10.800 15.120 N VTI1A n/a
2 TRCN0000043361 CGAGCAAATTGGTCAGGAGAT pLKO.1 606 CDS 100% 4.050 5.670 N VTI1A n/a
3 TRCN0000236385 CACGAATAGTCATCGAGTATT pLKO_005 2632 3UTR 100% 13.200 10.560 N VTI1A n/a
4 TRCN0000236387 TCGGGAAACAGATGCTAATTT pLKO_005 681 CDS 100% 15.000 10.500 N VTI1A n/a
5 TRCN0000236386 ACTAGAGGCTGGATACCAAAT pLKO_005 573 CDS 100% 10.800 7.560 N VTI1A n/a
6 TRCN0000236389 GATACAGCGAGCACGTGAAAG pLKO_005 657 CDS 100% 10.800 7.560 N VTI1A n/a
7 TRCN0000043362 GCAGAGATCACCAGCAAGATT pLKO.1 208 CDS 100% 5.625 3.938 N VTI1A n/a
8 TRCN0000235559 ATCGCCTACAGTGACGAAGTA pLKO_005 436 CDS 100% 4.950 3.465 N Vti1a n/a
9 TRCN0000043359 GATACCAAATAGCAGTGGAAA pLKO.1 584 CDS 100% 4.950 3.465 N VTI1A n/a
10 TRCN0000043360 GTGGAGAAACAGCTTGAAGAA pLKO.1 280 CDS 100% 4.950 3.465 N VTI1A n/a
11 TRCN0000043358 GCTACAAACAAGAAATGGGAA pLKO.1 386 CDS 100% 2.640 1.848 N VTI1A n/a
12 TRCN0000012176 GAACAGATGGATTTGGAAGTT pLKO.1 316 CDS 100% 4.950 3.465 N Vti1a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001365712.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.