Transcript: Human NM_001366134.1

Homo sapiens family with sequence similarity 131 member A (FAM131A), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-03-22
Taxon:
Homo sapiens (human)
Gene:
FAM131A (131408)
Length:
2577
CDS:
427..1272

Additional Resources:

NCBI RefSeq record:
NM_001366134.1
NBCI Gene record:
FAM131A (131408)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001366134.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000263482 CACCTCTCCATCGTCTCTAAA pLKO_005 1829 3UTR 100% 13.200 9.240 N FAM131A n/a
2 TRCN0000263486 ATGAGCTGCTTCTCGCCAAAC pLKO_005 1004 CDS 100% 6.000 4.200 N FAM131A n/a
3 TRCN0000263485 CCACTGATGACTCCTATGATG pLKO_005 749 CDS 100% 4.950 3.465 N FAM131A n/a
4 TRCN0000167861 GCTTTGGAATGATGAAAGCAT pLKO.1 1922 3UTR 100% 0.300 0.210 N FAM131A n/a
5 TRCN0000265011 AGGACTTGCCAGAGGTGAATG pLKO_005 389 5UTR 100% 10.800 5.400 Y Fam131a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001366134.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14379 pDONR223 100% 99.8% 1% None 7delC n/a
2 ccsbBroad304_14379 pLX_304 0% 99.8% 1% V5 (not translated due to prior stop codon) 7delC n/a
Download CSV