Transcript: Human NM_001366279.1

Homo sapiens transmembrane serine protease 7 (TMPRSS7), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-05-01
Taxon:
Homo sapiens (human)
Gene:
TMPRSS7 (344805)
Length:
2271
CDS:
70..2190

Additional Resources:

NCBI RefSeq record:
NM_001366279.1
NBCI Gene record:
TMPRSS7 (344805)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001366279.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000245945 CTCAGGAATCCGGGCATATTT pLKO_005 708 CDS 100% 15.000 21.000 N TMPRSS7 n/a
2 TRCN0000245944 TTAGATGCTCCTCCGGTTTAT pLKO_005 1124 CDS 100% 13.200 18.480 N TMPRSS7 n/a
3 TRCN0000245943 ATGCTCTGTGCAGGCATAATG pLKO_005 1975 CDS 100% 13.200 9.240 N TMPRSS7 n/a
4 TRCN0000245942 TTGTGGTCCACGAGTACTATA pLKO_005 1697 CDS 100% 13.200 9.240 N TMPRSS7 n/a
5 TRCN0000245941 AGCGTTGTGATGGAGTAAATG pLKO_005 1160 CDS 100% 13.200 7.920 N TMPRSS7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001366279.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13607 pDONR223 100% 80.9% 80.8% None 1_402del;2035A>T n/a
2 ccsbBroad304_13607 pLX_304 0% 80.9% 80.8% V5 1_402del;2035A>T n/a
3 TRCN0000472068 TTGTTTAGTCGAATGTCGGCAGCA pLX_317 24.4% 80.9% 80.8% V5 1_402del;2035A>T n/a
Download CSV