Construct: ORF TRCN0000472068
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF008512.1_s317c1
- Derived from:
- ccsbBroadEn_13607
- DNA Barcode:
- TTGTTTAGTCGAATGTCGGCAGCA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- TMPRSS7 (344805)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000472068
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 344805 | TMPRSS7 | transmembrane serine protea... | NM_001366279.1 | 80.9% | 80.8% | 1_402del;2035A>T |
| 2 | human | 344805 | TMPRSS7 | transmembrane serine protea... | NM_001042575.2 | 79.7% | 79.6% | 1_435del;2068A>T |
| 3 | human | 344805 | TMPRSS7 | transmembrane serine protea... | XM_011512754.1 | 75.2% | 75.1% | 1_564del;2197A>T |
| 4 | human | 344805 | TMPRSS7 | transmembrane serine protea... | NR_026734.1 | 65.4% | 1_718del;2351A>T;2435_2622del | |
| 5 | mouse | 208171 | Tmprss7 | transmembrane serine protea... | XM_006521918.2 | 87% | 91.4% | (many diffs) |
| 6 | mouse | 208171 | Tmprss7 | transmembrane serine protea... | XM_017316909.1 | 87% | 91.4% | (many diffs) |
| 7 | mouse | 208171 | Tmprss7 | transmembrane serine protea... | XM_017316910.1 | 70.5% | 70.9% | (many diffs) |
| 8 | mouse | 208171 | Tmprss7 | transmembrane serine protea... | XM_017316911.1 | 70.5% | 70.9% | (many diffs) |
| 9 | mouse | 208171 | Tmprss7 | transmembrane serine protea... | XM_017316912.1 | 63.2% | 65.6% | (many diffs) |
| 10 | mouse | 208171 | Tmprss7 | transmembrane serine protea... | XM_017316908.1 | 61.1% | 64.1% | (many diffs) |
| 11 | mouse | 208171 | Tmprss7 | transmembrane serine protea... | XM_017316907.1 | 61% | 64% | (many diffs) |
| 12 | mouse | 208171 | Tmprss7 | transmembrane serine protea... | XM_006521916.2 | 60.1% | 63.1% | (many diffs) |
| 13 | mouse | 208171 | Tmprss7 | transmembrane serine protea... | NM_172455.3 | 60.1% | 63% | (many diffs) |
| 14 | mouse | 208171 | Tmprss7 | transmembrane serine protea... | XM_006521914.2 | 60.1% | 63% | (many diffs) |
| 15 | mouse | 208171 | Tmprss7 | transmembrane serine protea... | XM_006521915.2 | 60.1% | 63% | (many diffs) |
| 16 | mouse | 208171 | Tmprss7 | transmembrane serine protea... | XM_006521917.2 | 56.5% | 59.4% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1785
- ORF length:
- 1716
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gtgtcacttc aagctggtgg ccatagtggg ctacctgatt cgtctctcaa 121 tcaagtccat ccaaatcgaa gccgacaact gtgtcactga ctccctgacc atttacgact 181 cccttttgcc catccggagc agcatcttgt acagaatttg tgaacccaca agaacattaa 241 tgtcatttgt ttctacaaat aatctcatgt tggtgacatt taagtctcct catatacgga 301 ggctctcagg aatccgggca tattttgagg tcattccaga acaaaagtgt gaaaacacag 361 tgttggtcaa agacatcact ggctttgaag ggaaaatttc aagcccatat tacccgagct 421 actatcctcc aaaatgcaag tgtacctgga aatttcagac ttctctatca actcttggca 481 tagcactgaa attctataac tattcaataa ccaagaagag tatgaaaggc tgtgagcatg 541 gatggtggga aattaatgag cacatgtact gtggctccta catggatcat cagacaattt 601 ttcgagtgcc cagccctctg gttcacattc agctccagtg cagttcaagg ctttcagaca 661 agccactttt ggcagaatat ggcagttaca acatcagtca accctgccct gttggatctt 721 ttagatgctc ctccggttta tgtgtccctc aggcccagcg ttgtgatgga gtaaatgact 781 gctttgatga aagtgatgaa ctgttttgcg tgagccctca acctgcctgc aataccagct 841 ccttcaggca gcatggccct ctcatctgtg atggcttcag ggactgtgag aatggccggg 901 atgagcaaaa ctgcactcaa agtattccat gcaacaacag aacttttaag tgtggcaatg 961 atatttgctt taggaaacaa aatgcaaaat gtgatgggac agtggattgt ccagatggaa 1021 gtgatgaaga aggctgcacc tgcagcagga gttcctccgc ccttcaccgc atcatcggag 1081 gcacagacac cctggagggg ggttggccgt ggcaggtcag cctccacttt gttggatctg 1141 cctactgtgg tgcctcagtc atctccaggg agtggcttct ttctgcagcc cactgttttc 1201 atggaaacag gctgtcagat cccacaccat ggactgcaca cctcgggatg tatgttcagg 1261 ggaatgccaa gtttgtctcc ccggtgagaa gaattgtggt ccacgagtac tataacagtc 1321 agacttttga ttatgatatt gctttgctac agctcagtat tgcctggccT GAGACCCTGA 1381 AACAGCTCAT TCAGCCAATA TGCATTCCTC CCACTGGTCA GAGAGTTCGC AGTGGGGAGA 1441 AGTGCTGGGT AACTGGCTGG GGGCGAAGAC ACGAAGCAGA TAATAAAGGC TCCCTCGTTC 1501 TGCAGCAAGC GGAGGTAGAG CTCATTGATC AAACGCTCTG TGTTTCCACC TACGGGATCA 1561 TCACTTCTCG GATGCTCTGT GCAGGCATAA TGTCAGGCAA GAGAGATGCC TGCAAAGGAG 1621 ATTCGGGTGG ACCTTTATCT TGTCGAAGAA AAAGTGATGG AAAATGGATT TTGACTGGCA 1681 TTGTTAGCTG GGGACATGGA TGTGGACGAC CAAACTTTCC TGGTGTTTAC ACAAGGGTGT 1741 CAAACTTTGT TCCCTGGATT CATAAATATG TCCCTTCTCT TTTGTTGCCA ACTTTCTTGT 1801 ACAAAGTGGT TGATATCGGT AAGCCTATCC CTAACCCTCT CCTCGGTCTC GATTCTACGT 1861 AGTAATGAAC TAGTCCGTAA CTTGAAAGTA TTTCGATTTC TTGGCTTTAT ATATCTTGTG 1921 GAAAGGACGA TTGTTTAGTC GAATGTCGGC AGCAACGCGT TAAGTCgaca atcaacctct 1981 ggattacaaa atttgtgaaa gatt