Transcript: Human NM_001366583.1

Homo sapiens transmembrane O-mannosyltransferase targeting cadherins 3 (TMTC3), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-06-09
Taxon:
Homo sapiens (human)
Gene:
TMTC3 (160418)
Length:
6756
CDS:
467..2518

Additional Resources:

NCBI RefSeq record:
NM_001366583.1
NBCI Gene record:
TMTC3 (160418)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001366583.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000137638 GCTAACCTGATCCGAGCAAAT pLKO.1 1376 CDS 100% 10.800 7.560 N TMTC3 n/a
2 TRCN0000136904 CCTAAGGATCTGCCATAGATT pLKO.1 4110 3UTR 100% 5.625 3.938 N TMTC3 n/a
3 TRCN0000138331 CGACTTCCGAAGTGCTTTGTT pLKO.1 1870 CDS 100% 5.625 3.938 N TMTC3 n/a
4 TRCN0000136826 CCAATTGCCTTGACAGTGTTT pLKO.1 290 5UTR 100% 4.950 3.465 N TMTC3 n/a
5 TRCN0000137372 GCATTAGAAGACCCACTCTTA pLKO.1 4081 3UTR 100% 4.950 3.465 N TMTC3 n/a
6 TRCN0000137021 CAGATGATATTGGTGCCCATA pLKO.1 1203 CDS 100% 4.050 2.835 N TMTC3 n/a
7 TRCN0000133967 CTGGACAGAAATAATGCAGAT pLKO.1 1547 CDS 100% 4.050 2.835 N TMTC3 n/a
8 TRCN0000138232 CCAGATGATATTGGTGCCCAT pLKO.1 1202 CDS 100% 2.160 1.512 N TMTC3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001366583.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05107 pDONR223 100% 74.7% 74.7% None 0_1ins693 n/a
2 ccsbBroad304_05107 pLX_304 0% 74.7% 74.7% V5 0_1ins693 n/a
Download CSV