Transcript: Human NM_001366890.1

Homo sapiens DENN domain containing 5B (DENND5B), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-03-22
Taxon:
Homo sapiens (human)
Gene:
DENND5B (160518)
Length:
3254
CDS:
305..2521

Additional Resources:

NCBI RefSeq record:
NM_001366890.1
NBCI Gene record:
DENND5B (160518)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001366890.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000180116 CGCCCACTATCCTCAGAATAT pLKO.1 550 CDS 100% 13.200 18.480 N DENND5B n/a
2 TRCN0000147648 GCGATACAACTCCTATGATAT pLKO.1 892 CDS 100% 13.200 18.480 N DENND5B n/a
3 TRCN0000110177 CGGACATCTATATATCAGAAA pLKO.1 2189 CDS 100% 4.950 6.930 N Dennd5b n/a
4 TRCN0000110176 GCGGACATCTATATATCAGAA pLKO.1 2188 CDS 100% 4.950 6.930 N Dennd5b n/a
5 TRCN0000429725 ACACTCGGATTGATAAGATAA pLKO_005 2139 CDS 100% 13.200 10.560 N DENND5B n/a
6 TRCN0000421360 ACGGCAATGTCTGTACTAATA pLKO_005 1671 CDS 100% 13.200 10.560 N DENND5B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001366890.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.