Transcript: Human NM_001367089.1

Homo sapiens sialic acid binding Ig like lectin 1 (SIGLEC1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-06-08
Taxon:
Homo sapiens (human)
Gene:
SIGLEC1 (6614)
Length:
6753
CDS:
107..5212

Additional Resources:

NCBI RefSeq record:
NM_001367089.1
NBCI Gene record:
SIGLEC1 (6614)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001367089.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000153962 CAGTTCCATTAAGTGGCTCAA pLKO.1 919 CDS 100% 4.050 5.670 N SIGLEC1 n/a
2 TRCN0000155147 GTGTGGAGATTCACAACCCTT pLKO.1 2124 CDS 100% 2.640 3.696 N SIGLEC1 n/a
3 TRCN0000420000 ACTTCTCCTGGTTCCGAAATG pLKO_005 2328 CDS 100% 10.800 8.640 N SIGLEC1 n/a
4 TRCN0000431725 GACTTCAACATGATAGAATTT pLKO_005 5597 3UTR 100% 13.200 9.240 N SIGLEC1 n/a
5 TRCN0000417948 GCTCTAACAAGAGACCAAATA pLKO_005 5572 3UTR 100% 13.200 9.240 N SIGLEC1 n/a
6 TRCN0000412901 ACATCTGTTCTGCCTCAAATG pLKO_005 4938 CDS 100% 10.800 7.560 N SIGLEC1 n/a
7 TRCN0000154843 GAGAACCAGACAGTGACACTA pLKO.1 1118 CDS 100% 4.950 3.465 N SIGLEC1 n/a
8 TRCN0000156121 CTTCGAGATCAGTGAGGTCAA pLKO.1 454 CDS 100% 4.050 2.835 N SIGLEC1 n/a
9 TRCN0000155705 CAACTCCACCTTTGCATGGTT pLKO.1 4531 CDS 100% 3.000 2.100 N SIGLEC1 n/a
10 TRCN0000154205 CAGGTGATGACACCTATGTTT pLKO.1 4359 CDS 100% 0.563 0.394 N SIGLEC1 n/a
11 TRCN0000155418 CAGAACTGATGCTGCCCTTTA pLKO.1 2401 CDS 100% 10.800 6.480 N SIGLEC1 n/a
12 TRCN0000152770 GCAGCCATAACTTTGACACAA pLKO.1 2948 CDS 100% 4.950 2.970 N SIGLEC1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001367089.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.