Transcript: Human NM_001370089.1

Homo sapiens coactivator associated arginine methyltransferase 1 (CARM1), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-07-07
Taxon:
Homo sapiens (human)
Gene:
CARM1 (10498)
Length:
3020
CDS:
50..1702

Additional Resources:

NCBI RefSeq record:
NM_001370089.1
NBCI Gene record:
CARM1 (10498)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001370089.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000381340 TGCTTTCATCGGCTCCATAAT pLKO_005 1123 CDS 100% 13.200 18.480 N CARM1 n/a
2 TRCN0000007169 CTATGACTTGAGCAGTGTTAT pLKO.1 1495 CDS 100% 13.200 9.240 N CARM1 n/a
3 TRCN0000280242 CTATGACTTGAGCAGTGTTAT pLKO_005 1495 CDS 100% 13.200 9.240 N CARM1 n/a
4 TRCN0000007167 CGATTTCTGTTCCTTCTACAA pLKO.1 289 CDS 100% 4.950 3.465 N CARM1 n/a
5 TRCN0000280298 CGATTTCTGTTCCTTCTACAA pLKO_005 289 CDS 100% 4.950 3.465 N CARM1 n/a
6 TRCN0000007166 CTATGGGAACTGGGACACTTT pLKO.1 1824 3UTR 100% 4.950 3.465 N CARM1 n/a
7 TRCN0000280243 CTATGGGAACTGGGACACTTT pLKO_005 1824 3UTR 100% 4.950 3.465 N CARM1 n/a
8 TRCN0000007168 GCAGAACATGATGCAGGACTA pLKO.1 421 CDS 100% 4.050 2.835 N CARM1 n/a
9 TRCN0000280244 GCAGAACATGATGCAGGACTA pLKO_005 421 CDS 100% 4.050 2.835 N CARM1 n/a
10 TRCN0000039118 CCCGACCAACACCATGCACTA pLKO.1 1672 CDS 100% 1.350 0.945 N Carm1 n/a
11 TRCN0000011071 GCCACAACAACCTGATTCCTT pLKO.1 1536 CDS 100% 3.000 1.800 N CARM1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001370089.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.