Transcript: Human NM_001370205.1

Homo sapiens solute carrier family 9 member B2 (SLC9B2), transcript variant 10, mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
SLC9B2 (133308)
Length:
4289
CDS:
621..1874

Additional Resources:

NCBI RefSeq record:
NM_001370205.1
NBCI Gene record:
SLC9B2 (133308)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001370205.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000431932 TTTACTGGACAGGGTCATAAC pLKO_005 866 CDS 100% 10.800 15.120 N SLC9B2 n/a
2 TRCN0000421325 TCCCAGTCATCAACGATAATG pLKO_005 925 CDS 100% 13.200 9.240 N SLC9B2 n/a
3 TRCN0000130328 GAGAGACTTCTGTGCAAGTTT pLKO.1 1904 3UTR 100% 5.625 3.938 N SLC9B2 n/a
4 TRCN0000128451 GAGACAGTTATGAAGCTCAAA pLKO.1 714 CDS 100% 4.950 3.465 N SLC9B2 n/a
5 TRCN0000130694 CATCTGCTCTTCTTGCCCATT pLKO.1 1102 CDS 100% 4.050 2.835 N SLC9B2 n/a
6 TRCN0000128354 CAAATGAACCAACAGAAGGAA pLKO.1 745 CDS 100% 3.000 2.100 N SLC9B2 n/a
7 TRCN0000127770 GCAAGGTCACATGGAGAGAAA pLKO.1 1735 CDS 100% 4.950 2.970 N SLC9B2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001370205.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13174 pDONR223 100% 74.3% 63.9% None (many diffs) n/a
2 ccsbBroad304_13174 pLX_304 0% 74.3% 63.9% V5 (many diffs) n/a
Download CSV