Transcript: Human NM_001370302.1

Homo sapiens tetraspanin 11 (TSPAN11), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-05-07
Taxon:
Homo sapiens (human)
Gene:
TSPAN11 (441631)
Length:
5506
CDS:
61..822

Additional Resources:

NCBI RefSeq record:
NM_001370302.1
NBCI Gene record:
TSPAN11 (441631)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001370302.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000254476 TATAGTGACCAAGCGTCTAAA pLKO_005 4620 3UTR 100% 13.200 18.480 N TSPAN11 n/a
2 TRCN0000254701 ACCGACTCCAGCAGGATTTCA pLKO_005 500 CDS 100% 5.625 4.500 N TSPAN11 n/a
3 TRCN0000254478 GAGTCCTGGCCCATGTGTATT pLKO_005 383 CDS 100% 13.200 9.240 N TSPAN11 n/a
4 TRCN0000254477 GATCATCTACTTGAAGTATTT pLKO_005 96 CDS 100% 13.200 9.240 N TSPAN11 n/a
5 TRCN0000265535 CCGCCTACATCCTCATCTTTG pLKO_005 239 CDS 100% 10.800 7.560 N TSPAN11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001370302.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10169 pDONR223 100% 99.7% 99.6% None 468T>C;569T>C n/a
2 ccsbBroad304_10169 pLX_304 0% 99.7% 99.6% V5 468T>C;569T>C n/a
3 TRCN0000477031 TATTGCCAAGGCAATTTACTTTAA pLX_317 43.2% 99.7% 99.6% V5 468T>C;569T>C n/a
Download CSV