Transcript: Human NM_001370358.1

Homo sapiens roundabout guidance receptor 3 (ROBO3), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
ROBO3 (64221)
Length:
1679
CDS:
151..1458

Additional Resources:

NCBI RefSeq record:
NM_001370358.1
NBCI Gene record:
ROBO3 (64221)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001370358.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000061232 CCCGGACGACAGATATTACAA pLKO.1 261 CDS 100% 5.625 7.875 N ROBO3 n/a
2 TRCN0000061228 GCATTGAGAATATCATGAGTG pLKO.1 1470 3UTR 100% 4.050 2.835 N ROBO3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001370358.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12461 pDONR223 100% 33.7% 33.7% None 1_858del;1240_1245delCGGAGT n/a
2 ccsbBroad304_12461 pLX_304 0% 33.7% 33.7% V5 1_858del;1240_1245delCGGAGT n/a
Download CSV