Transcript: Human NM_001370372.1

Homo sapiens phosphatidylinositol specific phospholipase C X domain containing 1 (PLCXD1), transcript variant 6, mRNA.

Source:
NCBI, updated 2019-06-09
Taxon:
Homo sapiens (human)
Gene:
PLCXD1 (55344)
Length:
5100
CDS:
264..1079

Additional Resources:

NCBI RefSeq record:
NM_001370372.1
NBCI Gene record:
PLCXD1 (55344)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001370372.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000078247 CGGCTTCGTCAGTGACGTCAT pLKO.1 1028 CDS 100% 1.350 1.080 N PLCXD1 n/a
2 TRCN0000303368 GAACCTGCACTTTGTCCATAT pLKO_005 611 CDS 100% 10.800 7.560 N PLCXD1 n/a
3 TRCN0000310671 GATGATCCTCAAGAACGTTAT pLKO_005 4758 3UTR 100% 10.800 7.560 N PLCXD1 n/a
4 TRCN0000078244 CAACAGGTCATCGTCTCCTAT pLKO.1 693 CDS 100% 4.950 3.465 N PLCXD1 n/a
5 TRCN0000078245 GATGACGTACTGCCTGAACAA pLKO.1 404 CDS 100% 4.950 3.465 N PLCXD1 n/a
6 TRCN0000291886 GATGACGTACTGCCTGAACAA pLKO_005 404 CDS 100% 4.950 3.465 N PLCXD1 n/a
7 TRCN0000136653 GCCTGACCAACATGGTGAAAT pLKO.1 1307 3UTR 100% 13.200 6.600 Y IQCC n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001370372.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08527 pDONR223 100% 83.7% 83.9% None 6T>C;392_393ins156 n/a
2 ccsbBroad304_08527 pLX_304 0% 83.7% 83.9% V5 6T>C;392_393ins156 n/a
Download CSV