Transcript: Human NM_001370959.1

Homo sapiens POU class 6 homeobox 2 (POU6F2), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-30
Taxon:
Homo sapiens (human)
Gene:
POU6F2 (11281)
Length:
6123
CDS:
46..2208

Additional Resources:

NCBI RefSeq record:
NM_001370959.1
NBCI Gene record:
POU6F2 (11281)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001370959.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000422012 TGCAGAACCTGACCGAGTTTA pLKO_005 1910 CDS 100% 13.200 18.480 N POU6F2 n/a
2 TRCN0000430556 CCGAGAAGTAGTTAGAGTTTG pLKO_005 2073 CDS 100% 10.800 15.120 N POU6F2 n/a
3 TRCN0000015954 CCGAGAATTTGCCAAAGCTTT pLKO.1 1584 CDS 100% 4.950 3.960 N POU6F2 n/a
4 TRCN0000015953 GCCCTGAAGAACACAATTAAA pLKO.1 2113 CDS 100% 15.000 10.500 N POU6F2 n/a
5 TRCN0000416945 AGATCCTCAATGCCCACTTTG pLKO_005 1991 CDS 100% 10.800 7.560 N Pou6f2 n/a
6 TRCN0000015955 GCTAGAGGAAACCCAGCATTA pLKO.1 325 CDS 100% 10.800 7.560 N POU6F2 n/a
7 TRCN0000015956 CCAATCCTCTACAGCTGGTTA pLKO.1 1004 CDS 100% 4.950 3.465 N POU6F2 n/a
8 TRCN0000015957 GAGTGAAATGAATGCGGAGTT pLKO.1 198 CDS 100% 4.050 2.835 N POU6F2 n/a
9 TRCN0000426343 ATGCACAAGGACAGATTATTG pLKO_005 1145 CDS 100% 13.200 9.240 N Pou6f2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001370959.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.