Transcript: Human NM_001371187.1

Homo sapiens unc-13 homolog B (UNC13B), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-09-30
Taxon:
Homo sapiens (human)
Gene:
UNC13B (10497)
Length:
7960
CDS:
683..6655

Additional Resources:

NCBI RefSeq record:
NM_001371187.1
NBCI Gene record:
UNC13B (10497)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001371187.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000380609 CAACAACTGCCACGACTTATA pLKO_005 4630 CDS 100% 13.200 18.480 N UNC13B n/a
2 TRCN0000381554 TGATGAGTGTGTTCGACAAAT pLKO_005 5512 CDS 100% 13.200 18.480 N UNC13B n/a
3 TRCN0000380732 CCGCATTAAGGTGCGTGTATG pLKO_005 3802 CDS 100% 10.800 15.120 N UNC13B n/a
4 TRCN0000380075 GTAACCGGCTTAGGGTCTTTG pLKO_005 6725 3UTR 100% 10.800 15.120 N UNC13B n/a
5 TRCN0000320458 GAAGATCCGAGAGCGAAATAA pLKO_005 3487 CDS 100% 15.000 12.000 N UNC13B n/a
6 TRCN0000002356 CTCTCTACATACAGGAATAAT pLKO.1 4436 CDS 100% 15.000 10.500 N UNC13B n/a
7 TRCN0000320384 CTCTCTACATACAGGAATAAT pLKO_005 4436 CDS 100% 15.000 10.500 N UNC13B n/a
8 TRCN0000002358 CCGGACCCAGAACATTATCAT pLKO.1 3448 CDS 100% 5.625 3.938 N UNC13B n/a
9 TRCN0000320383 CCGGACCCAGAACATTATCAT pLKO_005 3448 CDS 100% 5.625 3.938 N UNC13B n/a
10 TRCN0000002360 CCATTAAGAGAGAAGGACAAA pLKO.1 6900 3UTR 100% 4.950 3.465 N UNC13B n/a
11 TRCN0000320385 CCATTAAGAGAGAAGGACAAA pLKO_005 6900 3UTR 100% 4.950 3.465 N UNC13B n/a
12 TRCN0000002359 CGAGTCCTATGAGTTGCAGAT pLKO.1 6394 CDS 100% 4.050 2.835 N UNC13B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001371187.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.