Transcript: Human NM_001371250.1

Homo sapiens family with sequence similarity 131 member B (FAM131B), transcript variant f, mRNA.

Source:
NCBI, updated 2019-07-03
Taxon:
Homo sapiens (human)
Gene:
FAM131B (9715)
Length:
4591
CDS:
443..1441

Additional Resources:

NCBI RefSeq record:
NM_001371250.1
NBCI Gene record:
FAM131B (9715)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001371250.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000418740 TCCTATCTTGGGCCTGCATTT pLKO_005 1097 CDS 100% 10.800 15.120 N FAM131B n/a
2 TRCN0000074326 GCCAGCGATCAGTCCCTCATT pLKO.1 1058 CDS 100% 1.650 1.320 N FAM131B n/a
3 TRCN0000422462 ACTCTAACGCCTATGGCATTG pLKO_005 579 CDS 100% 6.000 4.200 N FAM131B n/a
4 TRCN0000074325 CTGAGCAAACTCGAACTGATT pLKO.1 492 CDS 100% 4.950 3.465 N FAM131B n/a
5 TRCN0000374615 AGCTTAAGCGAAACTCTAATG pLKO_005 567 CDS 100% 10.800 7.560 N Fam131b n/a
6 TRCN0000074324 CCGAAGCTTAAGCGAAACTTT pLKO.1 563 CDS 100% 5.625 3.938 N FAM131B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001371250.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07472 pDONR223 100% 91.9% 91.3% None (many diffs) n/a
2 ccsbBroad304_07472 pLX_304 0% 91.9% 91.3% V5 (many diffs) n/a
Download CSV