Transcript: Human NM_001371560.1

Homo sapiens mal, T cell differentiation protein like (MALL), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-15
Taxon:
Homo sapiens (human)
Gene:
MALL (7851)
Length:
2191
CDS:
31..366

Additional Resources:

NCBI RefSeq record:
NM_001371560.1
NBCI Gene record:
MALL (7851)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001371560.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000182904 CCACACTTTGTTTGGACATTT pLKO.1 524 3UTR 100% 13.200 10.560 N MALL n/a
2 TRCN0000178767 CGAGCTGATATTTGGGTTCTT pLKO.1 129 CDS 100% 4.950 3.465 N MALL n/a
3 TRCN0000148504 CTCGTTTCTCATCTCCTTGAT pLKO.1 225 CDS 100% 4.950 3.465 N MALL n/a
4 TRCN0000419342 TCCTGTTGTCTTACTTGTTTG pLKO_005 248 CDS 100% 10.800 6.480 N MALL n/a
5 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 1036 3UTR 100% 5.625 2.813 Y KLHL30 n/a
6 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 1036 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001371560.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01834 pDONR223 100% 72.5% 72.5% None 272_273ins126 n/a
2 ccsbBroad304_01834 pLX_304 0% 72.5% 72.5% V5 272_273ins126 n/a
Download CSV