Transcript: Human NM_001371783.1

Homo sapiens LON peptidase N-terminal domain and ring finger 2 (LONRF2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-07-25
Taxon:
Homo sapiens (human)
Gene:
LONRF2 (164832)
Length:
15138
CDS:
1180..2715

Additional Resources:

NCBI RefSeq record:
NM_001371783.1
NBCI Gene record:
LONRF2 (164832)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001371783.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000007828 CCGACGGATATTAGTCATCAT pLKO.1 2637 CDS 100% 4.950 6.930 N LONRF2 n/a
2 TRCN0000007825 CGTGCTTTAGTGTGTAGACAA pLKO.1 3095 3UTR 100% 4.950 6.930 N LONRF2 n/a
3 TRCN0000435674 TTCCATCCAAAGCAGATTAAA pLKO_005 1428 CDS 100% 15.000 10.500 N LONRF2 n/a
4 TRCN0000431238 GCTATAACACAGCGGACATTG pLKO_005 2330 CDS 100% 10.800 7.560 N LONRF2 n/a
5 TRCN0000428552 GGTTTGGGTTTCACGAGAAAG pLKO_005 3027 3UTR 100% 10.800 7.560 N LONRF2 n/a
6 TRCN0000007829 GCAAGCAGAAACTTTAACATA pLKO.1 1933 CDS 100% 5.625 3.938 N LONRF2 n/a
7 TRCN0000007826 GCTGGCTTAAAGAGACAGTTT pLKO.1 1639 CDS 100% 4.950 3.465 N LONRF2 n/a
8 TRCN0000007827 CCTCTCTTGATTAAGGGACAT pLKO.1 1234 CDS 100% 4.050 2.835 N LONRF2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001371783.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.