Transcript: Human NM_001372061.1

Homo sapiens exportin 4 (XPO4), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-06
Taxon:
Homo sapiens (human)
Gene:
XPO4 (64328)
Length:
9543
CDS:
37..3150

Additional Resources:

NCBI RefSeq record:
NM_001372061.1
NBCI Gene record:
XPO4 (64328)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001372061.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000105647 CCGCTAATACCTCCAGAAATA pLKO.1 1711 CDS 100% 13.200 18.480 N Xpo4 n/a
2 TRCN0000324184 CCGCTAATACCTCCAGAAATA pLKO_005 1711 CDS 100% 13.200 18.480 N Xpo4 n/a
3 TRCN0000377513 TAACCGTGTTCCCACGAAATG pLKO_005 1091 CDS 100% 10.800 15.120 N XPO4 n/a
4 TRCN0000164776 CTCCGCTAATACCTCCAGAAA pLKO.1 1709 CDS 100% 4.950 6.930 N XPO4 n/a
5 TRCN0000165701 CCCAGATTGACAACGTAGCAA pLKO.1 2492 CDS 100% 3.000 4.200 N XPO4 n/a
6 TRCN0000377512 ATCGAGTCTCTGCGAACATTC pLKO_005 304 CDS 100% 10.800 8.640 N XPO4 n/a
7 TRCN0000429602 AGATTCTGAATGGTGATTTAA pLKO_005 3373 3UTR 100% 15.000 10.500 N XPO4 n/a
8 TRCN0000159095 GCCATTTCATTGCCTTAATTT pLKO.1 4029 3UTR 100% 15.000 10.500 N XPO4 n/a
9 TRCN0000370130 GCCGAAGCCCACCTCTTAATT pLKO_005 2240 CDS 100% 15.000 10.500 N XPO4 n/a
10 TRCN0000376566 TTGCAGTTTGCAAGCATATTT pLKO_005 188 CDS 100% 15.000 10.500 N XPO4 n/a
11 TRCN0000159557 GCCTGAAACTTTGATATGTAT pLKO.1 3267 3UTR 100% 5.625 3.938 N XPO4 n/a
12 TRCN0000105645 GCTACCTCTTAGCTGATGATA pLKO.1 1676 CDS 100% 5.625 3.938 N Xpo4 n/a
13 TRCN0000324181 GCTACCTCTTAGCTGATGATA pLKO_005 1676 CDS 100% 5.625 3.938 N Xpo4 n/a
14 TRCN0000160271 CCAGAGAATAAGGAACTGATT pLKO.1 6752 3UTR 100% 4.950 3.465 N XPO4 n/a
15 TRCN0000159748 GCACATAAACAGATATGCTAT pLKO.1 2623 CDS 100% 4.950 3.465 N XPO4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001372061.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.