Transcript: Human NM_001372305.1

Homo sapiens potassium voltage-gated channel subfamily C member 3 (KCNC3), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-30
Taxon:
Homo sapiens (human)
Gene:
KCNC3 (3748)
Length:
6441
CDS:
218..2263

Additional Resources:

NCBI RefSeq record:
NM_001372305.1
NBCI Gene record:
KCNC3 (3748)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001372305.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000433006 GCCTTCTTGGACCCTTTAAAG pLKO_005 2616 3UTR 100% 13.200 9.240 N KCNC3 n/a
2 TRCN0000044909 CCAGACAAGGTGGAGTTTCTT pLKO.1 1100 CDS 100% 5.625 3.938 N KCNC3 n/a
3 TRCN0000044908 CCCGTCATTGTCAACAACTTT pLKO.1 1595 CDS 100% 5.625 3.938 N KCNC3 n/a
4 TRCN0000420113 AGCGGCAAGATCGTGATCAAC pLKO_005 248 CDS 100% 4.950 3.465 N KCNC3 n/a
5 TRCN0000044910 CTCCAACCACACCTACTTCAA pLKO.1 1432 CDS 100% 4.950 3.465 N KCNC3 n/a
6 TRCN0000415389 TGCTTCCTCCTCACCGACTAT pLKO_005 2108 CDS 100% 4.950 3.465 N KCNC3 n/a
7 TRCN0000044912 GCTTCATCCATATTAGCAACA pLKO.1 930 CDS 100% 4.050 2.835 N KCNC3 n/a
8 TRCN0000166364 CACACACACACACACACACAA pLKO.1 6056 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001372305.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.