Transcript: Human NM_001374420.1

Homo sapiens NIMA related kinase 1 (NEK1), transcript variant 8, mRNA.

Source:
NCBI, updated 2019-09-25
Taxon:
Homo sapiens (human)
Gene:
NEK1 (4750)
Length:
5961
CDS:
535..4260

Additional Resources:

NCBI RefSeq record:
NM_001374420.1
NBCI Gene record:
NEK1 (4750)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001145167 ATAACTGAGACACCAAACTG pXPR_003 CGG 698 19% 10 0.9981 NEK1 NEK1 76128
2 BRDN0001148922 TTCAGGTGACAAGTAGTATG pXPR_003 GGG 502 13% 8 0.6145 NEK1 NEK1 76127
3 BRDN0001149235 ACAGTAGTTTAACTGATACC pXPR_003 CGG 2022 54% 23 0.0628 NEK1 NEK1 76126
4 BRDN0001146251 GCATTTGGTCAAAAATGGCA pXPR_003 TGG 1292 35% 16 -0.0348 NEK1 NEK1 76125
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001374420.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000232042 ACAAAGCCTGCCGCTAAATAT pLKO_005 1459 CDS 100% 15.000 21.000 N NEK1 n/a
2 TRCN0000219755 GGATCTGTTTAAGCGAATAAA pLKO.1 792 CDS 100% 15.000 21.000 N NEK1 n/a
3 TRCN0000232041 GGATCTGTTTAAGCGAATAAA pLKO_005 792 CDS 100% 15.000 21.000 N NEK1 n/a
4 TRCN0000232043 AGATTGAAGGCGGTGTCTAAA pLKO_005 2008 CDS 100% 13.200 18.480 N NEK1 n/a
5 TRCN0000382291 CCATCAGTCAACTCCATATTG pLKO_005 1273 CDS 100% 13.200 18.480 N NEK1 n/a
6 TRCN0000381805 GGAAACTCAGTCGGCAGATAG pLKO_005 3276 CDS 100% 10.800 15.120 N NEK1 n/a
7 TRCN0000021581 CCGCTAAATATGGAATACCTT pLKO.1 1469 CDS 100% 3.000 2.400 N NEK1 n/a
8 TRCN0000379609 AGTTTGGTGTCTCAGTTATTT pLKO_005 1231 CDS 100% 15.000 10.500 N NEK1 n/a
9 TRCN0000380515 ATACAGTGGGAGAAGTTATTA pLKO_005 2837 CDS 100% 15.000 10.500 N NEK1 n/a
10 TRCN0000381533 AGAGCTTGCCATGCACTATTA pLKO_005 3221 CDS 100% 13.200 9.240 N NEK1 n/a
11 TRCN0000021580 CGAGAAATACTTCGTAGATTA pLKO.1 2611 CDS 100% 13.200 9.240 N NEK1 n/a
12 TRCN0000196437 GACTTAGCATATAGCTTAAAG pLKO.1 5002 3UTR 100% 13.200 9.240 N NEK1 n/a
13 TRCN0000219756 TTTCGATCTCACTCGCATTTA pLKO.1 3526 CDS 100% 13.200 9.240 N NEK1 n/a
14 TRCN0000257305 TTTCGATCTCACTCGCATTTA pLKO_005 3526 CDS 100% 13.200 9.240 N NEK1 n/a
15 TRCN0000380409 AGAGCCTGGAACCAATGATTC pLKO_005 3372 CDS 100% 10.800 7.560 N NEK1 n/a
16 TRCN0000194812 CGATAGTGTCTTTAACCATTT pLKO.1 4020 CDS 100% 10.800 7.560 N NEK1 n/a
17 TRCN0000021583 CCTTGCTGATTGGACTTTCAA pLKO.1 3572 CDS 100% 5.625 3.938 N NEK1 n/a
18 TRCN0000021579 CCTCAACTATATGAAAGCATT pLKO.1 4281 3UTR 100% 4.950 3.465 N NEK1 n/a
19 TRCN0000021582 CGCCAACAGATTAAAGCCAAA pLKO.1 2197 CDS 100% 4.050 2.835 N NEK1 n/a
20 TRCN0000194960 CCAGATGTTCTTCGTAATAAA pLKO.1 5274 3UTR 100% 15.000 9.000 N NEK1 n/a
21 TRCN0000232044 CCAGATGTTCTTCGTAATAAA pLKO_005 5274 3UTR 100% 15.000 9.000 N NEK1 n/a
22 TRCN0000381612 GACCCAGAACCTGACTTAATG pLKO_005 4529 3UTR 100% 13.200 7.920 N NEK1 n/a
23 TRCN0000379972 TGATTCCTCTGGATGAGTTAA pLKO_005 2783 CDS 100% 13.200 7.920 N NEK1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001374420.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.